The short version of GLP-1 fits in a sentence. The long version — which is the one that helps — is below.
Reviewed 2025-10-02. Anything still debated is marked as such rather than presented as settled.
Semaglutide is a synthetic peptide analogue of glucagon-like peptide-1, a gut hormone released after nutrient intake. The molecule contains 31 amino acid residues and differs from the native sequence at several positions. A non-natural residue at position eight resists the enzyme that normally truncates the hormone, while a lysine-linked fatty diacid side chain promotes binding to serum albumin. These two modifications extend the circulating half-life from minutes to roughly one week. The peptide is produced by solid-phase synthesis followed by selective acylation, and its identity and purity are confirmed by spectrometric and chromatographic techniques.
The primary target is the GLP-1 receptor, a class B G protein-coupled receptor expressed on pancreatic beta cells, in the gut, and in several brain regions. Receptor activation raises intracellular cyclic AMP, which potentiates glucose-dependent insulin secretion and lowers glucagon release when blood glucose is elevated. Signalling in the hypothalamus and brainstem is associated with reduced appetite and slower gastric emptying. Because the insulinotropic effect depends on prevailing glucose levels, the hypoglycaemic risk of the peptide alone is described as low in most study settings. The relative contribution of peripheral and central actions remains an active research question.
Large randomised trials in adults with type 2 diabetes and in adults with obesity have reported reductions in body weight and improvements in several cardiovascular risk markers. One outcome trial found a lower incidence of major adverse cardiovascular events in participants with diabetes and established cardiovascular disease. Gastrointestinal effects such as nausea and vomiting are the most frequently reported adverse events and often diminish over time. Changes in lean body mass during weight loss are an area of ongoing investigation. Effects in adolescents and in pregnancy are less well characterised, and current labelling advises against use during pregnancy.
Semaglutide is a synthetic peptide analog of glucagon-like peptide-1, a hormone released from intestinal L-cells after food intake. It contains 31 amino acids and differs from native GLP-1 through modifications that slow enzymatic breakdown. The peptide was developed to extend the short circulating half-life of endogenous GLP-1, which is measured in minutes. Researchers introduced the compound in the early 2010s. Two backbone changes and a fatty acid side chain define its structure, distinguishing it from earlier GLP-1 receptor agonists.
The compound binds the GLP-1 receptor on pancreatic beta cells and other tissues, activating a G-protein signaling cascade that raises intracellular cyclic AMP. This action increases glucose-dependent insulin secretion when blood glucose is elevated, while binding also slows gastric emptying and reduces glucagon release. In the central nervous system, receptor activation in the hypothalamus and brainstem contributes to reduced appetite. The fatty acid chain binds albumin, which protects the peptide from renal filtration and enzymatic degradation. This albumin binding is central to its extended circulation time.
| Property | Value | Notes |
|---|---|---|
| Molecular class | Acylated GLP-1 receptor agonist | 31-residue synthetic peptide |
| Molecular formula | C187H291N45O59 | established for the free peptide |
| Appearance | White to off-white powder | as supplied before formulation |
| Solubility | Freely soluble in water | aqueous buffers near neutral pH |
| Typical storage | 2 to 8 degrees Celsius, protected from light | powder and solution forms differ in shelf life |
Serum protein binding dominates the pharmacokinetic profile. The attached chain associates strongly with albumin, shielding the peptide from enzymatic attack and slowing filtration by the kidney. This interaction extends the circulation half-life to roughly one week in humans, which supports weekly administration intervals. An oral version pairs the peptide with an absorption enhancer that transiently alters gastric epithelium, permitting limited uptake; bioavailability by that route is substantially lower than by injection.
Semaglutide belongs to the glucagon-like peptide-1 receptor agonist class, a group of synthetic peptides that imitate an incretin hormone released by intestinal L cells after food intake. Native GLP-1 circulates for only a few minutes because dipeptidyl peptidase-4 cleaves it rapidly. The hormone acts on pancreatic islets, the gastrointestinal tract, and several brain regions. Because the natural peptide is short-lived, development work concentrated on analogues that keep receptor activity while resisting enzymatic breakdown and renal clearance.
Reversed-phase high-performance liquid chromatography with ultraviolet detection is the dominant approach for peptide purity assessment, usually paired with mass spectrometry to confirm molecular mass and sequence. Peptide mapping by enzymatic digestion and tandem mass spectrometry locates modifications such as deamidation and oxidation. Quantitation in plasma matrices can be performed by LC-MS/MS after solid-phase extraction. Method validation follows general guidance on accuracy, precision, linearity, and limits of detection. Comparability of results between laboratories, when no shared reference standard is available, remains an open question.
Stability studies focus on deamidation of asparagine and glutamine residues, oxidation of methionine, and aggregation into higher-order species. The fatty acid side chain adds susceptibility to oxidative change and can promote self-association at high concentration. Lyophilised material is comparatively robust when kept cold and dry, while aqueous solutions require refrigeration and protection from light. Forced degradation experiments under heat, acid, base, and peroxide conditions establish the specificity of each analytical method. Which degradation route dominates under real storage conditions depends on the formulation and stays formulation-specific.
Handling guidance for research quantities calls for single-use aliquots, an inert atmosphere where practical, and avoidance of repeated freeze-thaw cycles that accelerate aggregation. Certificates of analysis typically report purity by peak area, water content, counter-ion identity, and residual solvent levels. In the scientific literature the compound is usually described by its full amino acid sequence, its registry number, or its structural class rather than by any proprietary label. Reporting standards vary between journals, and reviewers increasingly request raw chromatograms alongside tabulated purity figures. Whether current purity thresholds are adequate for every experimental context is debated.
Identity and purity are usually assessed by reverse-phase high-performance liquid chromatography coupled to mass spectrometry. Retention time and observed mass are compared against a reference standard run under identical conditions. Impurity profiles reveal deamidation products, oxidized methionine variants, and truncated fragments that arise during synthesis or storage. Peptide mapping through enzymatic digestion confirms the primary sequence, while amino acid analysis offers an independent check on overall composition.
Stability studies examine how temperature, pH, and moisture influence degradation rates over time. In aqueous solution, hydrolysis and deamidation accelerate as pH moves away from mildly acidic conditions. Light exposure and residual metal ions can also trigger oxidation of susceptible residues. Accelerated aging at elevated temperature is used to estimate shelf life, though extrapolation to room temperature carries uncertainty because individual degradation pathways do not always scale predictably.
Lyophilized semaglutide powder is typically held at minus twenty degrees Celsius for long-term storage. At that temperature, solid-state degradation reactions proceed slowly and the peptide remains intact for extended periods. Repeated freeze-thaw cycles are best avoided because they promote aggregation and can shift the proportion of monomeric peptide present. Working aliquots are often prepared so that each portion is thawed only once, and desiccant is placed inside the vial to limit moisture uptake.
=== PVP/PVA hydrogels for articular cartilage replacement === Poly(vinyl alcohol) (PVA) hydrogels were used in this study. It was difficult to meet the mechanical properties of articular cartilage using this hydrogel. There was no inflammatory or degenerative changes in articular cartilage or synovial membrane surround this artificial PVA cartilage. PVP hydrogels were also studied. They exhibit high hydrophilicity, biocompatibility, and complexing ability. When used as a blend of PVA/PVP hydrogel, they produced similar internal 3D structure and water content as natural articular cartilage. The best mechanical properties and friction system were blended hydrogel with 1 wt. % PVP. Due to the greater inter-chain hydrogen bonding, adding PVP to the pure PVA proved a better option. They acted exactly with a characteristic viscoelastic behavior of articular cartilage.
== History == The enzyme classification and nomenclature list was first approved by the International Union of Biochemistry in 1961. Six enzyme classes had been recognized based on the type of chemical reaction catalyzed, including oxidoreductases (EC 1), transferases (EC 2), hydrolases (EC 3), lyases (EC 4), isomerases (EC 5) and ligases (EC 6). However, it became apparent that none of these could describe the important group of enzymes that catalyse the movement of ions or molecules across membranes or their separation within membranes. Several of these involve the hydrolysis of ATP and had been previously classified as ATPases (EC 3.6.3.-), although the hydrolytic reaction is not their primary function. In August 2018, the International Union of Biochemistry and Molecular Biology classified these enzymes under a new enzyme class (EC) of translocases (EC 7).
He influenced the works of Francis Bacon, René Descartes, Giordano Bruno, Tommaso Campanella and Thomas Hobbes. In 1602 Campanella wrote his most famous work, The City of the Sun and later defended Galileo Galilei during his first trial with his work A Defense of Galileo, which was published in 1622. In 1613 philosopher and economist Antonio Serra wrote A Short Treatise on the Wealth and Poverty of Nations and was a pioneer in the Mercantilist tradition. Calabria was important to the Spanish monarchs beginning in the reign of Emperor Charles V of Habsburg, who held the title of King of Naples, as when the sovereign granted royal privileges to Catanzaro. The city had resisted the 28 August 1528 siege by a French army supported by some FrancophileCalabrian and Apulian nobles. In gratitude, Charles V granted the city the right to use the imperial eagle as its symbol, exempted it from royal tributes and gave it the power to mint coins worth one carlin. The emperor personally visited the region in 1535 on his return from the capture of Tunis, where, at the command of a fleet of as many as 500 ships, he had defeated the Ottoman army and freed 20,000 Christian slaves. After the African conquest, Charles V landed in Sicily and then in Calabria. Having passed Aspromonte, he visited Nicastro, Martirano, Carpanzano, Rogliano, Tessano and Cosenza. From there the monarch passed through Bisignano, Castrovillari and Laino, and continued to Naples. During Spanish rule in Calabria, many towns tried to defend themselves from Saracen raids.
Sources: en.wikipedia.org
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
Spironolactone can also have numerous other interactions, most commonly with other cardiac and blood-pressure medications, for instance digoxin. Licorice, which has indirect mineralocorticoid activity by inhibiting mineralocorticoid metabolism, has been found to inhibit the antimineralocorticoid effects of spironolactone. Moreover, the addition of licorice to spironolactone has been found to reduce the antimineralocorticoid side effects of spironolactone in women treated with it for hyperandrogenism, and licorice hence may be used to reduce these side effects in women treated with spironolactone as an antiandrogen who are bothered by them. Conversely, spironolactone is useful in reversing licorice-induced hypokalemia. Aspirin and other NSAIDs have been found to attenuate the diuresis and natriuresis induced by spironolactone, but not to affect its antihypertensive effect. Some research has suggested that spironolactone might be able to interfere with the effectiveness of antidepressant treatment. As the medication acts as an antimineralocorticoid, it might be able to reduce the effectiveness of certain antidepressants by interfering with normalization of the hypothalamic–pituitary–adrenal axis and by increasing levels of glucocorticoids such as cortisol. Other research contradicts this hypothesis and has suggested that spironolactone might produce antidepressant effect, for instance, in studies showing antidepressant-like effects of spironolactone in animals.
== Abiogenic origins == Acetyl phosphate (AcP), a precursor to ATP, can readily be synthesized at modest yields from thioacetate in pH 7 and 20 °C and pH 8 and 50 °C, although acetyl phosphate is less stable in warmer temperatures and alkaline conditions than in cooler and acidic to neutral conditions. It is unable to promote polymerization of ribonucleotides and amino acids and was only capable of phosphorylation of organic compounds. It was shown that it can promote aggregation and stabilization of AMP in the presence of Na+, aggregation of nucleotides could promote polymerization above 75 °C in the absence of Na+. It is possible that polymerization promoted by AcP could occur at mineral surfaces. It was shown that ADP can only be phosphorylated to ATP by AcP and other nucleoside triphosphates were not phosphorylated by AcP. This might explain why all lifeforms use ATP to drive biochemical reactions.
=== GLC (1981–1985) === The equivalent American Mazda GLC (Great Little Car) appeared in the 1981 model year, although the rear-wheel drive wagon also continued to be offered. It was only offered with a single engine – the twin-barrel 1.5-litre with 68 hp (51 kW)—and lasted through 1985, after which it was replaced by the next-generation Mazda 323. With this, the GLC nameplate was retired. The BD was the only front-wheel drive Mazda vehicle using the GLC name. Originally it was offered with three- or five-door bodywork, in standard, Custom, Custom L, or Sport equipment levels. The five-door only came as a Custom and was sold only in Hawaii and Puerto Rico. All cars received exposed rectangular sealed-beam units. The later four-door saloon, introduced for 1983, was available in Custom, Custom L, and Sport models. The Sport received blacked out trim, a steering wheel borrowed from the RX-7, full instrumentation, and a special rear interior which closely integrates the side trim with the rear seat design – an early iteration of a design philosophy taken to its extreme with the 1988 Persona and the 1990 Eunos Cosmo. Unlike the sporting 323s in other markets, the Sport only received special hubcaps, rather than alloy wheels. For 1982, the Sport was made to live up to its name a little bit more, with the installation of a front anti-roll bar and cast aluminum wheels. The five-door GLC gained a fully carpeted trunk for 1982.
Sources: en.wikipedia.org
The galactic year, GY, is the time it takes the Solar System to revolve once around the galactic core, approximately 250 million years (megaannum or "Ma"). It is a convenient unit for long-term measurements. For example, oceans appeared on Earth after 4 GY, life is detectable at 5 GY, and multicellular organisms first appeared at 15 GY. The age of the Earth is estimated at 20 GY. This use of GY is not to be confused with Gyr for gigayear or Gy for Gray (unit).
==== Refeeding syndrome ==== When a malnourished person is refed too quickly, they may develop refeeding syndrome (RFS), which can be life-threatening. Factors associated with increased risk for RFS include:
It has been recorded growing under Pinus and Tsuga in Sagarmatha National Park in Nepal, as well as in the Indian forests of Arunachal Pradesh. In West Asia, the species has been reported from the northwest forests of Iran.
Sources: en.wikipedia.org
Native GLP-1 is degraded within minutes by dipeptidyl peptidase-4 and neutral endopeptidases. Semaglutide carries a non-natural amino acid at position eight that blocks that cleavage, and a fatty diacid side chain that binds albumin. The result is a much longer duration of action than the native hormone.
The fatty diacid chain associates strongly with serum albumin, which keeps the peptide in circulation and shields it from rapid renal clearance. Bound peptide is released gradually, producing a sustained receptor signal. This mechanism also reduces the peak-to-trough variation seen with shorter-acting analogues.
The balance between peripheral receptor activation and signalling in the central nervous system is not fully resolved. The extent to which slowed gastric emptying accounts for reduced energy intake, compared with direct effects on appetite circuits, is debated. Long-term effects on lean mass and on tissues outside the gut and brain are still under study.
It is a synthetic analog of GLP-1 produced through medicinal chemistry to resist enzymatic degradation. The design goal was longer circulation than the native hormone.